| p-value: | 1e-12 |
| log p-value: | -2.933e+01 |
| Information Content per bp: | 1.854 |
| Number of Target Sequences with motif | 414.0 |
| Percentage of Target Sequences with motif | 41.40% |
| Number of Background Sequences with motif | 256.2 |
| Percentage of Background Sequences with motif | 25.93% |
| Average Position of motif in Targets | 227.7 +/- 156.4bp |
| Average Position of motif in Background | 249.0 +/- 176.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.29 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-193a-5p MIMAT0004614 Homo sapiens miR-193a-5p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.79 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAGACC-- TCATCTCGCCCGCAAAGACCCA |
|
|
|
hsa-miR-3667-5p MIMAT0018089 Homo sapiens miR-3667-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.79 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AAGACC--------------- AAAGACCCATTGAGGAGAAGGT |
|
|
|
hsa-miR-1182 MIMAT0005827 Homo sapiens miR-1182 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.71 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAGACC--- GTCACATCCCTCCCAAGACCCTC |
|
|
|
hsa-miR-200c* MIMAT0004657 Homo sapiens miR-200c* Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.67 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------AAGACC CCAAACACTGCTGGGTAAGACG |
|
|
|
hsa-miR-4696 MIMAT0019790 Homo sapiens miR-4696 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.67 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AAGACC------------- TGCAAGACGGATACTGTCATCT |
|
|
|
hsa-miR-3663-5p MIMAT0018084 Homo sapiens miR-3663-5p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.67 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AAGACC--- CCGAGCACCACGCAGACCAGC |
|
|
|
hsa-miR-208a MIMAT0000241 Homo sapiens miR-208a Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AAGACC-------------- ATAAGACGAGCAAAAAGCTTGT |
|
|
|
hsa-miR-208b MIMAT0004960 Homo sapiens miR-208b Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AAGACC-------------- ATAAGACGAACAAAAGGTTTGT |
|
|
|
hsa-miR-431 MIMAT0001625 Homo sapiens miR-431 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------AAGACC TGCATGACGGCCTGCAAGACA |
|
|
|
hsa-miR-550a* MIMAT0003257 Homo sapiens miR-550a* Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.65 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------AAGACC ATGTGCCTGAGGGAGTAAGACA |
|
|
|