| p-value: | 1e-6 |
| log p-value: | -1.420e+01 |
| Information Content per bp: | 1.917 |
| Number of Target Sequences with motif | 110.0 |
| Percentage of Target Sequences with motif | 11.00% |
| Number of Background Sequences with motif | 50.1 |
| Percentage of Background Sequences with motif | 5.07% |
| Average Position of motif in Targets | 225.5 +/- 127.7bp |
| Average Position of motif in Background | 255.3 +/- 171.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.08 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4797-3p MIMAT0019973 Homo sapiens miR-4797-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCTCAGT-------------- TCTCAGTAAGTGGCACTCTGT |
|
|
|
hsa-miR-4264 MIMAT0016899 Homo sapiens miR-4264 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.74 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCTCAGT---------- ACTCAGTCATGGTCATT |
|
|
|
hsa-miR-4461 MIMAT0018983 Homo sapiens miR-4461 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.72 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TCTCAGT- GCCTAGCCCTACTAGTCTCAATC |
|
|
|
hsa-miR-4499 MIMAT0019035 Homo sapiens miR-4499 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.72 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------TCTCAGT--- TCCCTCCTCTCAGTCTT |
|
|
|
hsa-miR-4251 MIMAT0016883 Homo sapiens miR-4251 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.72 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------TCTCAGT TTGGCCCTTTTCTCAGG |
|
|
|
hsa-miR-4329 MIMAT0016923 Homo sapiens miR-4329 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TCTCAGT GTGGAACTAGGGTCTCAGG |
|
|
|
hsa-miR-4276 MIMAT0016904 Homo sapiens miR-4276 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | TCTCAGT----------- -CTCAGTGACTCATGTGC |
|
|
|
hsa-miR-4324 MIMAT0016876 Homo sapiens miR-4324 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TCTCAGT- TTAAGGTTAGGGTCTCAGGG |
|
|
|
hsa-miR-4523 MIMAT0019061 Homo sapiens miR-4523 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.67 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCTCAGT- ACAGCCGAGGCCCTCTCGGTC |
|
|
|
hsa-miR-27b MIMAT0000419 Homo sapiens miR-27b Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCTCAGT------------- TTCACAGTGGCTAAGTTCTGC |
|
|
|