| p-value: | 1e-5 |
| log p-value: | -1.211e+01 |
| Information Content per bp: | 1.806 |
| Number of Target Sequences with motif | 491.0 |
| Percentage of Target Sequences with motif | 49.10% |
| Number of Background Sequences with motif | 387.5 |
| Percentage of Background Sequences with motif | 39.23% |
| Average Position of motif in Targets | 282.0 +/- 165.5bp |
| Average Position of motif in Background | 241.0 +/- 189.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.52 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4723-3p MIMAT0019839 Homo sapiens miR-4723-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.75 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGCTCTCT-------------- CCCTCTCTGGCTCCTCCCCAAA |
|
|
|
hsa-miR-4639-3p MIMAT0019698 Homo sapiens miR-4639-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCTCTCT----------- TCACTCTCACCTTGCTTTGC |
|
|
|
hsa-miR-4311 MIMAT0016863 Homo sapiens miR-4311 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.71 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CGCTCTCT--- CACACTCAGCTCTCTTTC |
|
|
|
hsa-miR-3183 MIMAT0015063 Homo sapiens miR-3183 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGCTCTCT-------------- GCCTCTCTCGGAGTCGCTCGGA |
|
|
|
hsa-miR-4693-3p MIMAT0019785 Homo sapiens miR-4693-3p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.70 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGCTCTCT AAATACTGTGAATTCCACTCTCA |
|
|
|
hsa-miR-4684-5p MIMAT0019769 Homo sapiens miR-4684-5p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.68 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | CGCTCTCT---------------- --CTCTCTACTGACTTGCAACATA |
|
|
|
hsa-miR-4306 MIMAT0016858 Homo sapiens miR-4306 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CGCTCTCT--- TACTGCCTTTCTCTCCA |
|
|
|
hsa-miR-4315 MIMAT0016866 Homo sapiens miR-4315 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCTCTCT--------- CCGCTTTCTGAGCTGGAC |
|
|
|
hsa-miR-3976 MIMAT0019361 Homo sapiens miR-3976 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.67 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CGCTCTCT--- ACATTAATCTTCCTGCTCTCTATA |
|
|
|
hsa-miR-4644 MIMAT0019704 Homo sapiens miR-4644 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.66 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------CGCTCTCT--- CTTCTGTCTCTTTTCTCTCTCCA |
|
|
|