| p-value: | 1e-9 |
| log p-value: | -2.232e+01 |
| Information Content per bp: | 1.766 |
| Number of Target Sequences with motif | 308.0 |
| Percentage of Target Sequences with motif | 30.80% |
| Number of Background Sequences with motif | 184.7 |
| Percentage of Background Sequences with motif | 18.70% |
| Average Position of motif in Targets | 244.7 +/- 158.3bp |
| Average Position of motif in Background | 245.8 +/- 176.6bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.17 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-186* MIMAT0004612 Homo sapiens miR-186* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.79 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TTTGGGC CCCAAAAAATTCACCTTTGGGC |
|
|
|
hsa-miR-4296 MIMAT0016845 Homo sapiens miR-4296 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.76 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTTGGGC--------- ATGTGGGCTCAGGCTCA |
|
|
|
hsa-miR-4265 MIMAT0016891 Homo sapiens miR-4265 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.75 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTTGGGC----------- CTGTGGGCTCAGCTCTGGG |
|
|
|
hsa-miR-4322 MIMAT0016873 Homo sapiens miR-4322 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.73 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTTGGGC------------- CTGTGGGCTCAGCGCGTGGGG |
|
|
|
hsa-miR-3926 MIMAT0018201 Homo sapiens miR-3926 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.71 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TTTGGGC- TCTCTGCCTGCTTTTTGGCCA |
|
|
|
hsa-miR-4260 MIMAT0016881 Homo sapiens miR-4260 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTTGGGC----------- CTTGGGGCATGGAGTCCCA |
|
|
|
hsa-miR-3136-3p MIMAT0019203 Homo sapiens miR-3136-3p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.69 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TTTGGGC-- ACTAACTGAATAGGTTGGGCCA |
|
|
|
hsa-miR-2113 MIMAT0009206 Homo sapiens miR-2113 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTTGGGC------------- ATTTGTGCTTGGCTCTGTCAC |
|
|
|
hsa-miR-2909 MIMAT0013863 Homo sapiens miR-2909 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTTGGGC------------- GTTAGGGCCAACATCTCTTGG |
|
|
|
hsa-miR-18b* MIMAT0004751 Homo sapiens miR-18b* Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TTTGGGC- GCCAGAAGGGGCATTTAGGGCA |
|
|
|