| p-value: | 1e-9 |
| log p-value: | -2.162e+01 |
| Information Content per bp: | 1.836 |
| Number of Target Sequences with motif | 166.0 |
| Percentage of Target Sequences with motif | 16.60% |
| Number of Background Sequences with motif | 75.9 |
| Percentage of Background Sequences with motif | 7.69% |
| Average Position of motif in Targets | 249.0 +/- 192.1bp |
| Average Position of motif in Background | 304.6 +/- 178.1bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.13 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-545* MIMAT0004785 Homo sapiens miR-545* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.69 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | ACCAGTAA--------------- -TCAGTAAATGTTTATTAGATGA |
|
|
|
hsa-miR-3923 MIMAT0018198 Homo sapiens miR-3923 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.68 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ACCAGTAA------------- AACTAGTAATGTTGGATTAGGG |
|
|
|
hsa-miR-582-5p MIMAT0003247 Homo sapiens miR-582-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ACCAGTAA AGTAACTGGTTGAACAACTGTAA |
|
|
|
hsa-miR-582-3p MIMAT0004797 Homo sapiens miR-582-3p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACCAGTAA GGTTCAGTTGTTCAACCAGTTA |
|
|
|
hsa-miR-548n MIMAT0005916 Homo sapiens miR-548n Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ACCAGTAA------------- CAAAAGTAATTGTGGATTTTGT |
|
|
|
hsa-miR-802 MIMAT0004185 Homo sapiens miR-802 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | ACCAGTAA----------------- --CAGTAACAAAGATTCATCCTTGT |
|
|
|
hsa-miR-99b MIMAT0000689 Homo sapiens miR-99b Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ACCAGTAA------------- CACCCGTAGAACCGACCTTGCG |
|
|
|
hsa-miR-100 MIMAT0000098 Homo sapiens miR-100 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ACCAGTAA------------- AACCCGTAGATCCGAACTTGTG |
|
|
|
hsa-miR-99a MIMAT0000097 Homo sapiens miR-99a Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ACCAGTAA------------- AACCCGTAGATCCGATCTTGTG |
|
|
|
hsa-miR-4709-5p MIMAT0019811 Homo sapiens miR-4709-5p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --ACCAGTAA------------ ACAACAGTGACTTGCTCTCCAA |
|
|
|