| p-value: | 1e-8 |
| log p-value: | -2.049e+01 |
| Information Content per bp: | 1.657 |
| Number of Target Sequences with motif | 223.0 |
| Percentage of Target Sequences with motif | 22.30% |
| Number of Background Sequences with motif | 120.2 |
| Percentage of Background Sequences with motif | 12.16% |
| Average Position of motif in Targets | 207.7 +/- 147.5bp |
| Average Position of motif in Background | 245.8 +/- 168.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.19 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4638-5p MIMAT0019695 Homo sapiens miR-4638-5p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AGACGAG- ACTTGTCCACCGCAGCCGAGT |
|
|
|
hsa-miR-208a MIMAT0000241 Homo sapiens miR-208a Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.68 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AGACGAG------------ ATAAGACGAGCAAAAAGCTTGT |
|
|
|
hsa-miR-4537 MIMAT0019080 Homo sapiens miR-4537 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.67 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAG------------- TGAGCCGAGCTGAGCTTAGCTG |
|
|
|
hsa-miR-877 MIMAT0004949 Homo sapiens miR-877 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAG----------- GTAGAGGAGATGGCGCAGGG |
|
|
|
hsa-miR-3663-5p MIMAT0018084 Homo sapiens miR-3663-5p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AGACGAG- CCGAGCACCACGCAGACCAGC |
|
|
|
hsa-miR-1238 MIMAT0005593 Homo sapiens miR-1238 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------AGACGAG---- GGGGCAGACAGACGAGGAAG |
|
|
|
hsa-miR-483-5p MIMAT0004761 Homo sapiens miR-483-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AGACGAG-------------- AAGACGGGAGGAAAGAAGGGAG |
|
|
|
hsa-miR-208b MIMAT0004960 Homo sapiens miR-208b Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AGACGAG------------ ATAAGACGAACAAAAGGTTTGT |
|
|
|
hsa-let-7d* MIMAT0004484 Homo sapiens let-7d* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAG------------- CTATACGACCTGCTGCCTTTCT |
|
|
|
hsa-miR-4655-3p MIMAT0019722 Homo sapiens miR-4655-3p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.61 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AGACGAG--- CCCCGGGGACCTGACGAGGGT |
|
|
|