| p-value: | 1e-7 |
| log p-value: | -1.830e+01 |
| Information Content per bp: | 1.816 |
| Number of Target Sequences with motif | 211.0 |
| Percentage of Target Sequences with motif | 21.10% |
| Number of Background Sequences with motif | 116.7 |
| Percentage of Background Sequences with motif | 11.81% |
| Average Position of motif in Targets | 255.8 +/- 154.5bp |
| Average Position of motif in Background | 241.3 +/- 177.0bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.15 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-1537 MIMAT0007399 Homo sapiens miR-1537 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.73 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGGTTTR ACAACTGTAACTAGACGGTTTT |
|
|
|
hsa-miR-451 MIMAT0001631 Homo sapiens miR-451 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------CGGTTTR AACTCAGTAATGGTAACGGTTT- |
|
|
|
hsa-miR-671-3p MIMAT0004819 Homo sapiens miR-671-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CGGTTTR------------ TCCGGTTCTCAGGGCTCCACC |
|
|
|
hsa-miR-299-5p MIMAT0002890 Homo sapiens miR-299-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGGTTTR--------------- TGGTTTACCGTCCCACATACAT |
|
|
|
hsa-miR-4748 MIMAT0019884 Homo sapiens miR-4748 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.62 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGGTTTR------------- GAGGTTTGGGGAGGATTTGCT |
|
|
|
hsa-miR-4464 MIMAT0018988 Homo sapiens miR-4464 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGGTTTR------------- AAGGTTTGGATAGATGCAATA |
|
|
|
hsa-miR-125b-1* MIMAT0004592 Homo sapiens miR-125b-1* Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGGTTTR-------------- ACGGGTTAGGCTCTTGGGAGCT |
|
|
|
hsa-miR-548ac MIMAT0018938 Homo sapiens miR-548ac Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.62 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CGGTTTR-- CAAAAGTAATTGCCGGTTTTTG |
|
|
|
hsa-miR-548z MIMAT0018446 Homo sapiens miR-548z Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.61 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGGTTTR-- TGCAAAAGTAATTGCGGTTTTTG |
|
|
|
hsa-miR-1468 MIMAT0006789 Homo sapiens miR-1468 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.61 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CGGTTTR------------ CTCCGTTTGCCTGTTTCGCTG |
|
|
|