| p-value: | 1e-7 |
| log p-value: | -1.752e+01 |
| Information Content per bp: | 1.796 |
| Number of Target Sequences with motif | 149.0 |
| Percentage of Target Sequences with motif | 14.90% |
| Number of Background Sequences with motif | 71.1 |
| Percentage of Background Sequences with motif | 7.20% |
| Average Position of motif in Targets | 260.8 +/- 177.4bp |
| Average Position of motif in Background | 215.8 +/- 155.0bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.09 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-646 MIMAT0003316 Homo sapiens miR-646 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AGCCGCT----------- AAGCAGCTGCCTCTGAGGC |
|
|
|
hsa-miR-337-5p MIMAT0004695 Homo sapiens miR-337-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.67 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AGCCGCT- AACTCCTGTATGAAGCCGTTC |
|
|
|
hsa-miR-4688 MIMAT0019777 Homo sapiens miR-4688 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AGCCGCT- CCCAGGTCCTCTGCTGCCCCTA |
|
|
|
hsa-miR-3648 MIMAT0018068 Homo sapiens miR-3648 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.66 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AGCCGCT-------------- AGCCGCGGGGATCGCCGAGGG |
|
|
|
hsa-miR-185* MIMAT0004611 Homo sapiens miR-185* Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------AGCCGCT GACCAGAGGAAAGCCAGCCCCT |
|
|
|
hsa-miR-1225-3p MIMAT0005573 Homo sapiens miR-1225-3p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.65 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGCCGCT------------- TGAGCCCCTGTGCCGCCCCCAG |
|
|
|
hsa-miR-423-5p MIMAT0004748 Homo sapiens miR-423-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AGCCGCT-- AAAGTCTCGCTCTCTGCCCCTCA |
|
|
|
hsa-miR-4749-3p MIMAT0019886 Homo sapiens miR-4749-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AGCCGCT--------------- CGCCCCTCCTGCCCCCACAGAA |
|
|
|
hsa-miR-4632 MIMAT0019688 Homo sapiens miR-4632 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AGCCGCT---------------- TGCCGCCCTCTCGCTGCTCTAGA |
|
|
|
hsa-miR-558 MIMAT0003222 Homo sapiens miR-558 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AGCCGCT-- ATTTTGGTACAGCAGCTCA |
|
|
|