| p-value: | 1e-6 |
| log p-value: | -1.452e+01 |
| Information Content per bp: | 1.929 |
| Number of Target Sequences with motif | 68.0 |
| Percentage of Target Sequences with motif | 6.80% |
| Number of Background Sequences with motif | 22.8 |
| Percentage of Background Sequences with motif | 2.31% |
| Average Position of motif in Targets | 209.2 +/- 164.0bp |
| Average Position of motif in Background | 204.2 +/- 150.1bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.05 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-2467-3p MIMAT0019953 Homo sapiens miR-2467-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.76 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | AAGCAGAG--------------- -AGCAGAGGCAGAGAGGCTCAGG |
|
|
|
hsa-miR-3194-3p MIMAT0019218 Homo sapiens miR-3194-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.76 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AAGCAGAG-- ACTGCCAGTGAGCAGCAGAGCT |
|
|
|
hsa-miR-922 MIMAT0004972 Homo sapiens miR-922 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.72 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AAGCAGAG-------------- GCAGCAGAGAATAGGACTACGTC |
|
|
|
hsa-miR-4522 MIMAT0019060 Homo sapiens miR-4522 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.70 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AAGCAGAG--- ACCGGCCTACAGGCAGAGTCA |
|
|
|
hsa-miR-593 MIMAT0004802 Homo sapiens miR-593 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.70 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------AAGCAGAG--- AGAAACCCCAGCAGAGACA |
|
|
|
hsa-miR-3678-3p MIMAT0018103 Homo sapiens miR-3678-3p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.68 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AAGCAGAG-------------- CTGCAGAGTTTGTACGGACCGG |
|
|
|
hsa-miR-4519 MIMAT0019056 Homo sapiens miR-4519 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AAGCAGAG---------- CAGCAGTGCGCAGGGCTG |
|
|
|
hsa-miR-3919 MIMAT0018193 Homo sapiens miR-3919 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.66 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | AAGCAGAG--------------- --GCAGAGAACAAAGGACTCAGT |
|
|
|
hsa-miR-632 MIMAT0003302 Homo sapiens miR-632 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------AAGCAGAG-- TCCCACAGGAAGCAGACAC |
|
|
|
hsa-miR-4468 MIMAT0018995 Homo sapiens miR-4468 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.66 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AAGCAGAG--------- AGAGCAGAAGGATGAGAT |
|
|
|